Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 122592 |
| Name | oriT1_CNCI 72|ColpHAD28  |
| Organism | Enterobacter hormaechei subsp. steigerwaltii strain CNCI 72 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JAPZBA010000041 (312..371 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT1_CNCI 72|ColpHAD28
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGAAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGAAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 23018 | GenBank | NZ_JAPZBA010000041 |
| Plasmid name | CNCI 72|ColpHAD28 | Incompatibility group | Col440II |
| Plasmid size | 8043 bp | Coordinate of oriT [Strand] | 312..371 [-]; 5935..5991 [-] |
| Host baterium | Enterobacter hormaechei subsp. steigerwaltii strain CNCI 72 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |