Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 122557 |
| Name | oriT1_FDAARGOS_1152|unnamed1  |
| Organism | Staphylococcus pasteuri strain FDAARGOS_1152 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP068217 ( 66688..66795 [+], 108 nt) |
| oriT length | 108 nt |
| IRs (inverted repeats) | 39..45, 49..55 (TTGGGGA..TCCCCAA) 9..16, 21..28 (ATTTTTTC..GAAAAAAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 108 nt
>oriT1_FDAARGOS_1152|unnamed1
TAGCCACTATTTTTTCGTCAGAAAAAATCATAAGGGGCTTGGGGAGTATCCCCAACAAGCAGGCGACGCTACCACGTTAGTGGCTAGCAAAGCCAATGATTGCCCAAA
TAGCCACTATTTTTTCGTCAGAAAAAATCATAAGGGGCTTGGGGAGTATCCCCAACAAGCAGGCGACGCTACCACGTTAGTGGCTAGCAAAGCCAATGATTGCCCAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22983 | GenBank | NZ_CP068217 |
| Plasmid name | FDAARGOS_1152|unnamed1 | Incompatibility group | - |
| Plasmid size | 104542 bp | Coordinate of oriT [Strand] | 37792..37899 [-]; 66688..66795 [+] |
| Host baterium | Staphylococcus pasteuri strain FDAARGOS_1152 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | arsR, arsB, arsC, mco |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |