Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 122550 |
| Name | oriT1_Aero52|p3  |
| Organism | Aeromonas caviae strain Aero52 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP066816 (2415..2589 [-], 175 nt) |
| oriT length | 175 nt |
| IRs (inverted repeats) | 101..106, 120..125 (ACAATC..GATTGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 175 nt
>oriT1_Aero52|p3
GTGACTCCGTGCGCGGTGAAAAATCGCATTTTAGCGCGTCACTGGTAGTTTAAAAACTGAGCTGGCATAATGCACGGCAAATCACGAAGTGCGCACTTATACAATCTCCACTCCGTTTCGATTGTGTGCGCCCTGCGGGGGCTGAAAGAAAACTGCAAAAGGCATTACGGCAGAA
GTGACTCCGTGCGCGGTGAAAAATCGCATTTTAGCGCGTCACTGGTAGTTTAAAAACTGAGCTGGCATAATGCACGGCAAATCACGAAGTGCGCACTTATACAATCTCCACTCCGTTTCGATTGTGTGCGCCCTGCGGGGGCTGAAAGAAAACTGCAAAAGGCATTACGGCAGAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22976 | GenBank | NZ_CP066816 |
| Plasmid name | Aero52|p3 | Incompatibility group | Col8282 |
| Plasmid size | 9797 bp | Coordinate of oriT [Strand] | 2415..2589 [-]; 6464..6637 [-] |
| Host baterium | Aeromonas caviae strain Aero52 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |