Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   122529
Name   oriT1_pSAA0430-08 in_silico
Organism   Streptococcus anginosus subsp. anginosus strain 0430-08
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_LC229233 ( 1802..1856 [-], 55 nt)
oriT length   55 nt
IRs (inverted repeats)      1..7, 9..15  (GTTGATA..TATCAAC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 55 nt

>oriT1_pSAA0430-08
GTTGATACTATCAACTTCCCACGGAATGTGGGGACAATTTCCCTTATGCTCTTTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   22955 GenBank   NZ_LC229233
Plasmid name   pSAA0430-08 Incompatibility group   -
Plasmid size   7038 bp Coordinate of oriT [Strand]   5425..5479 [+]; 1802..1856 [-]
Host baterium   Streptococcus anginosus subsp. anginosus strain 0430-08

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -