Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 122529 |
| Name | oriT1_pSAA0430-08  |
| Organism | Streptococcus anginosus subsp. anginosus strain 0430-08 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_LC229233 ( 1802..1856 [-], 55 nt) |
| oriT length | 55 nt |
| IRs (inverted repeats) | 1..7, 9..15 (GTTGATA..TATCAAC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 55 nt
>oriT1_pSAA0430-08
GTTGATACTATCAACTTCCCACGGAATGTGGGGACAATTTCCCTTATGCTCTTTT
GTTGATACTATCAACTTCCCACGGAATGTGGGGACAATTTCCCTTATGCTCTTTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22955 | GenBank | NZ_LC229233 |
| Plasmid name | pSAA0430-08 | Incompatibility group | - |
| Plasmid size | 7038 bp | Coordinate of oriT [Strand] | 5425..5479 [+]; 1802..1856 [-] |
| Host baterium | Streptococcus anginosus subsp. anginosus strain 0430-08 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |