Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 122480 |
| Name | oriT1_AH3|unnamed1  |
| Organism | Staphylococcus epidermidis strain AH3 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JAQPSG010000002 ( 48370..48489 [+], 120 nt) |
| oriT length | 120 nt |
| IRs (inverted repeats) | 52..59, 61..68 (TTGGGGAT..ATCCCCAA) 22..29, 34..41 (ATTTTTTC..GAAAAAAT) 1..9, 13..21 (AGTGGCTAA..TTAGCCACT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 120 nt
>oriT1_AH3|unnamed1
AGTGGCTAACAATTAGCCACTATTTTTTCGTCAGAAAAAATCCTAAGGGGCTTGGGGATAATCCCCAACAAGCAGGCGTCGATACCACGTTAGTGGCTAGCAAAGCCTATGCTTGCCAAA
AGTGGCTAACAATTAGCCACTATTTTTTCGTCAGAAAAAATCCTAAGGGGCTTGGGGATAATCCCCAACAAGCAGGCGTCGATACCACGTTAGTGGCTAGCAAAGCCTATGCTTGCCAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22906 | GenBank | NZ_JAQPSG010000002 |
| Plasmid name | AH3|unnamed1 | Incompatibility group | - |
| Plasmid size | 50894 bp | Coordinate of oriT [Strand] | 22923..23042 [+]; 48370..48489 [+] |
| Host baterium | Staphylococcus epidermidis strain AH3 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |