Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 122476 |
| Name | oriT1_P1927|p00003  |
| Organism | Klebsiella sp. P1927 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP073380 ( 108994..109043 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
TGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT1_P1927|p00003
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22902 | GenBank | NZ_CP073380 |
| Plasmid name | P1927|p00003 | Incompatibility group | IncFII |
| Plasmid size | 162093 bp | Coordinate of oriT [Strand] | 72404..72453 [+]; 108994..109043 [+] |
| Host baterium | Klebsiella sp. P1927 |
Cargo genes
| Drug resistance gene | rmtB, blaTEM-1B, blaCTX-M-65, catA2, blaKPC-2 |
| Virulence gene | - |
| Metal resistance gene | merR, merT, merP, merA, merD, merE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |