Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 122473 |
| Name | oriT1_IR5392|unnamed3  |
| Organism | Klebsiella oxytoca strain IR5392 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP064111 ( 36609..36707 [+], 99 nt) |
| oriT length | 99 nt |
| IRs (inverted repeats) | 77..82, 89..94 (AAAAAA..TTTTTT) 77..82, 88..93 (AAAAAA..TTTTTT) 31..38, 41..48 (AGCGTGAT..ATCACGCT) 17..23, 35..41 (TAAATCA..TGATTTA) |
| Location of nic site | 59..60 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 99 nt
>oriT1_IR5392|unnamed3
TTTGTTTTTTTTCTTTTAAATCAGTGCAATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTGTTTTTTTTCTTTTAAATCAGTGCAATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22899 | GenBank | NZ_CP064111 |
| Plasmid name | IR5392|unnamed3 | Incompatibility group | IncR |
| Plasmid size | 37970 bp | Coordinate of oriT [Strand] | 2874..2972 [+]; 36609..36707 [+] |
| Host baterium | Klebsiella oxytoca strain IR5392 |
Cargo genes
| Drug resistance gene | aph(6)-Id, aph(3'')-Ib |
| Virulence gene | - |
| Metal resistance gene | merR, merT, merP, merC, merA, merD, merE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |