Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 122448 |
| Name | oriT1_KOX 60|p6  |
| Organism | Klebsiella grimontii strain KOX 60 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP067439 (22192..22240 [+], 49 nt) |
| oriT length | 49 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | 32..33 |
| Conserved sequence flanking the nic site |
TGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 49 nt
>oriT1_KOX 60|p6
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 35934..46597
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| JIZ39_RS32765 (JIZ39_32765) | 31094..31414 | - | 321 | WP_004152720 | type II toxin-antitoxin system RelE/ParE family toxin | - |
| JIZ39_RS32770 (JIZ39_32770) | 31495..31719 | - | 225 | WP_014343499 | hypothetical protein | - |
| JIZ39_RS32775 (JIZ39_32775) | 31730..31942 | - | 213 | WP_019706020 | hypothetical protein | - |
| JIZ39_RS32780 (JIZ39_32780) | 32003..32359 | - | 357 | WP_019706019 | hypothetical protein | - |
| JIZ39_RS32785 (JIZ39_32785) | 33196..33609 | - | 414 | WP_023287139 | type II toxin-antitoxin system HigA family antitoxin | - |
| JIZ39_RS32790 (JIZ39_32790) | 33610..33888 | - | 279 | WP_004152721 | helix-turn-helix transcriptional regulator | - |
| JIZ39_RS32795 (JIZ39_32795) | 33878..34198 | - | 321 | WP_004152720 | type II toxin-antitoxin system RelE/ParE family toxin | - |
| JIZ39_RS32800 (JIZ39_32800) | 34279..34503 | - | 225 | WP_014343499 | hypothetical protein | - |
| JIZ39_RS32805 (JIZ39_32805) | 34514..34726 | - | 213 | WP_019706020 | hypothetical protein | - |
| JIZ39_RS32810 (JIZ39_32810) | 34787..35143 | - | 357 | WP_019706019 | hypothetical protein | - |
| JIZ39_RS32815 (JIZ39_32815) | 35282..35557 | - | 276 | Protein_55 | conjugal transfer protein TraN | - |
| JIZ39_RS32820 (JIZ39_32820) | 35554..35937 | - | 384 | WP_053390297 | hypothetical protein | - |
| JIZ39_RS32825 (JIZ39_32825) | 35934..36581 | - | 648 | WP_064343536 | type-F conjugative transfer system pilin assembly protein TrbC | trbC |
| JIZ39_RS32830 (JIZ39_32830) | 36594..37553 | - | 960 | WP_229295972 | conjugal transfer pilus assembly protein TraU | traU |
| JIZ39_RS32835 (JIZ39_32835) | 37597..38223 | - | 627 | WP_064343535 | type-F conjugative transfer system protein TraW | traW |
| JIZ39_RS32840 (JIZ39_32840) | 38220..38612 | - | 393 | WP_064343534 | type-F conjugative transfer system protein TrbI | - |
| JIZ39_RS32845 (JIZ39_32845) | 38612..41251 | - | 2640 | WP_064343533 | type IV secretion system protein TraC | virb4 |
| JIZ39_RS32850 (JIZ39_32850) | 41344..41727 | - | 384 | WP_042946290 | hypothetical protein | - |
| JIZ39_RS32855 (JIZ39_32855) | 41815..42114 | - | 300 | WP_053390308 | hypothetical protein | - |
| JIZ39_RS33935 | 42111..42512 | - | 402 | WP_064343532 | hypothetical protein | - |
| JIZ39_RS32865 (JIZ39_32865) | 42596..42784 | - | 189 | WP_053390286 | hypothetical protein | - |
| JIZ39_RS32870 (JIZ39_32870) | 43397..43981 | - | 585 | WP_064343530 | type IV conjugative transfer system lipoprotein TraV | traV |
| JIZ39_RS32875 (JIZ39_32875) | 44015..44449 | - | 435 | WP_020322358 | conjugal transfer protein TraP | - |
| JIZ39_RS32880 (JIZ39_32880) | 44442..45863 | - | 1422 | WP_053390199 | F-type conjugal transfer pilus assembly protein TraB | traB |
| JIZ39_RS32885 (JIZ39_32885) | 45863..46597 | - | 735 | WP_064343528 | type-F conjugative transfer system secretin TraK | traK |
| JIZ39_RS32890 (JIZ39_32890) | 47049..47159 | - | 111 | WP_139157850 | small membrane protein | - |
| JIZ39_RS32895 (JIZ39_32895) | 47364..47723 | - | 360 | WP_227637584 | hypothetical protein | - |
| JIZ39_RS32900 (JIZ39_32900) | 47858..48049 | - | 192 | WP_049106033 | hypothetical protein | - |
| JIZ39_RS32905 (JIZ39_32905) | 48291..49401 | + | 1111 | Protein_73 | IS3 family transposase | - |
| JIZ39_RS34135 | 49771..49884 | - | 114 | Protein_74 | replication initiation protein | - |
| JIZ39_RS32910 (JIZ39_32910) | 50300..50491 | + | 192 | WP_004187666 | Rop family plasmid primer RNA-binding protein | - |
| JIZ39_RS32915 (JIZ39_32915) | 50491..50892 | + | 402 | WP_064175096 | AlpA family transcriptional regulator | - |
Host bacterium
| ID | 22874 | GenBank | NZ_CP067439 |
| Plasmid name | KOX 60|p6 | Incompatibility group | ColRNAI |
| Plasmid size | 51460 bp | Coordinate of oriT [Strand] | 22192..22240 [+]; 50976..51026 [-] |
| Host baterium | Klebsiella grimontii strain KOX 60 |
Cargo genes
| Drug resistance gene | aac(6')-Ib |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |