Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 122351 |
| Name | oriT1_EB5|unnamed3  |
| Organism | Enterobacter cloacae complex sp. EB5 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP133866 ( 421..480 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT1_EB5|unnamed3
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22777 | GenBank | NZ_CP133866 |
| Plasmid name | EB5|unnamed3 | Incompatibility group | Col440II |
| Plasmid size | 9552 bp | Coordinate of oriT [Strand] | 5204..5263 [-]; 421..480 [-] |
| Host baterium | Enterobacter cloacae complex sp. EB5 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |