Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   122350
Name   oriT1_EB5|unnamed1 in_silico
Organism   Enterobacter cloacae complex sp. EB5
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP133865 ( 8299..8358 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT1_EB5|unnamed1
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   22776 GenBank   NZ_CP133865
Plasmid name   EB5|unnamed1 Incompatibility group   Col440II
Plasmid size   9873 bp Coordinate of oriT [Strand]   3378..3437 [+]; 8299..8358 [+]
Host baterium   Enterobacter cloacae complex sp. EB5

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -