Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 122324 |
| Name | oriT1_pBN62-17kb-2  |
| Organism | Lactococcus sp. bn62 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP120421 ( 16424..16560 [-], 137 nt) |
| oriT length | 137 nt |
| IRs (inverted repeats) | 21..28, 42..49 (AAAAGGGG..CCCCTTTT) |
| Location of nic site | 104..105 |
| Conserved sequence flanking the nic site |
GCTTGCAGTA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 137 nt
>oriT1_pBN62-17kb-2
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACCTCCCCCTTTTCAAGCCACATTGTAATACAAGAACGAAGTGCTTTGTATTACAATGTGATAGCTTGCAGTATTTATGGTTTTATATTTTCTATTTTGTT
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACCTCCCCCTTTTCAAGCCACATTGTAATACAAGAACGAAGTGCTTTGTATTACAATGTGATAGCTTGCAGTATTTATGGTTTTATATTTTCTATTTTGTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22751 | GenBank | NZ_CP120421 |
| Plasmid name | pBN62-17kb-2 | Incompatibility group | - |
| Plasmid size | 17034 bp | Coordinate of oriT [Strand] | 5540..5676 [-]; 16424..16560 [-] |
| Host baterium | Lactococcus sp. bn62 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |