Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   122230
Name   oriT1_pMS200408A_2 in_silico
Organism   Lactococcus formosensis strain MS200408A
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_AP027277 ( 1701..1837 [-], 137 nt)
oriT length   137 nt
IRs (inverted repeats)      21..28, 42..49  (AAAAGGGG..CCCCTTTT)
 25..30, 39..44  (GGGGAA..TTCCCC)
Location of nic site      104..105
Conserved sequence flanking the
  nic site  
 
 GCTTGCAGTA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 137 nt

>oriT1_pMS200408A_2
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCCACATTGTAATACAAGAACGAAGTGTTTTGTATTACAATGTGATAGCTTGCAGTATTTATGGGTTTATATTTTCTATTTTGTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   22657 GenBank   NZ_AP027277
Plasmid name   pMS200408A_2 Incompatibility group   -
Plasmid size   18832 bp Coordinate of oriT [Strand]   11117..11253 [-]; 1701..1837 [-]
Host baterium   Lactococcus formosensis strain MS200408A

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -