Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   122166
Name   oriT_ROVR10|unnamed3 in_silico
Organism   Raoultella planticola strain ROVR10
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JAHQRL010000060 (487..546 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_ROVR10|unnamed3
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   22593 GenBank   NZ_JAHQRL010000060
Plasmid name   ROVR10|unnamed3 Incompatibility group   Col440II
Plasmid size   4430 bp Coordinate of oriT [Strand]   487..546 [-]
Host baterium   Raoultella planticola strain ROVR10

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -