Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 122158 |
| Name | oriT_06-3595|p2  |
| Organism | Shigella boydii strain 06-3595 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JARKNR010000008 (949..1021 [+], 73 nt) |
| oriT length | 73 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 73 nt
>oriT_06-3595|p2
GTCGGGGTGAAGCCCTGACCAGGTGGGGAATGTCTGAGTGTGCGTGCGCGGTCCGACATTCCCACATCCTGTC
GTCGGGGTGAAGCCCTGACCAGGTGGGGAATGTCTGAGTGTGCGTGCGCGGTCCGACATTCCCACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22585 | GenBank | NZ_JARKNR010000008 |
| Plasmid name | 06-3595|p2 | Incompatibility group | Col |
| Plasmid size | 1921 bp | Coordinate of oriT [Strand] | 949..1021 [+] |
| Host baterium | Shigella boydii strain 06-3595 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |