Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   122157
Name   oriT_06-3595|p1 in_silico
Organism   Shigella boydii strain 06-3595
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JARKNR010000007 (4867..4926 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_06-3595|p1
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   22584 GenBank   NZ_JARKNR010000007
Plasmid name   06-3595|p1 Incompatibility group   ColRNAI
Plasmid size   8382 bp Coordinate of oriT [Strand]   4867..4926 [+]
Host baterium   Shigella boydii strain 06-3595

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -