Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   122156
Name   oriT_CIP 58-28|p1 in_silico
Organism   Shigella dysenteriae strain CIP 58-28
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JARFTJ010000008 (5957..6016 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_CIP 58-28|p1
GGGTGTCGGGGCGCAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACGGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   22583 GenBank   NZ_JARFTJ010000008
Plasmid name   CIP 58-28|p1 Incompatibility group   ColRNAI
Plasmid size   8348 bp Coordinate of oriT [Strand]   5957..6016 [-]
Host baterium   Shigella dysenteriae strain CIP 58-28

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -