Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 122155 |
| Name | oriT_CIP 58-23|p1 |
| Organism | Shigella boydii strain CIP 58-23 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JARKNN010000015 (2495..2553 [-], 59 nt) |
| oriT length | 59 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 59 nt
>oriT_CIP 58-23|p1
GGTGTCGGGGCGCAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
GGTGTCGGGGCGCAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22582 | GenBank | NZ_JARKNN010000015 |
| Plasmid name | CIP 58-23|p1 | Incompatibility group | Col |
| Plasmid size | 2783 bp | Coordinate of oriT [Strand] | 2495..2553 [-] |
| Host baterium | Shigella boydii strain CIP 58-23 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |