Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   122155
Name   oriT_CIP 58-23|p1 in_silico
Organism   Shigella boydii strain CIP 58-23
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JARKNN010000015 (2495..2553 [-], 59 nt)
oriT length   59 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 59 nt

>oriT_CIP 58-23|p1
GGTGTCGGGGCGCAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   22582 GenBank   NZ_JARKNN010000015
Plasmid name   CIP 58-23|p1 Incompatibility group   Col
Plasmid size   2783 bp Coordinate of oriT [Strand]   2495..2553 [-]
Host baterium   Shigella boydii strain CIP 58-23

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -