Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   122154
Name   oriT_201103097|p3 in_silico
Organism   Shigella boydii strain 201103097
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JARGEV010000013 (1111..1185 [-], 75 nt)
oriT length   75 nt
IRs (inverted repeats)      12..17, 20..25  (GCCCTG..CAGGGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 75 nt

>oriT_201103097|p3
GTCGGGGCAAAGCCCTGACCAGGGCAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   22581 GenBank   NZ_JARGEV010000013
Plasmid name   201103097|p3 Incompatibility group   ColRNAI
Plasmid size   2679 bp Coordinate of oriT [Strand]   1111..1185 [-]
Host baterium   Shigella boydii strain 201103097

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -