Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   122131
Name   oriT_pCol440I in_silico
Organism   Enterobacter hormaechei subsp. xiangfangensis strain APCR 84
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JARQZG010000034 (925..983 [+], 59 nt)
oriT length   59 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 59 nt

>oriT_pCol440I
GGGTTCCGGGCGCAGCGCCGGACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   22558 GenBank   NZ_JARQZG010000034
Plasmid name   pCol440I Incompatibility group   Col440I
Plasmid size   2444 bp Coordinate of oriT [Strand]   925..983 [+]
Host baterium   Enterobacter hormaechei subsp. xiangfangensis strain APCR 84

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -