Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 122125 |
| Name | oriT_IncC  |
| Organism | Enterobacter hormaechei subsp. steigerwaltii strain PEER 487 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JARDRT010000019 (23295..23399 [-], 105 nt) |
| oriT length | 105 nt |
| IRs (inverted repeats) | 56..61, 74..79 (TGGAAT..ATTCCA) 46..51, 56..61 (ATTCCA..TGGAAT) 1..6, 8..13 (AATTTG..CAAATT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 105 nt
>oriT_IncC
AATTTGACAAATTCCAAAGATGGGTTAGCCTAGTGACAGAACTAGATTCCAGTATTGGAATAATCAGCTTTAAATTCCAGATAGATAGTTATGTGGATAGGAATT
AATTTGACAAATTCCAAAGATGGGTTAGCCTAGTGACAGAACTAGATTCCAGTATTGGAATAATCAGCTTTAAATTCCAGATAGATAGTTATGTGGATAGGAATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22552 | GenBank | NZ_JARDRT010000019 |
| Plasmid name | IncC | Incompatibility group | IncA/C2 |
| Plasmid size | 50530 bp | Coordinate of oriT [Strand] | 23295..23399 [-] |
| Host baterium | Enterobacter hormaechei subsp. steigerwaltii strain PEER 487 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |