Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 122123 |
Name | oriT_ColpHAD28 |
Organism | Enterobacter hormaechei subsp. xiangfangensis strain CNCI 200 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_JAPZPX010000060 (1047..1105 [+], 59 nt) |
oriT length | 59 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 59 nt
>oriT_ColpHAD28
GGGTTCCGGGCGCAGCGCCGGACCAGTCACGCAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTCCGGGCGCAGCGCCGGACCAGTCACGCAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 22550 | GenBank | NZ_JAPZPX010000060 |
Plasmid name | ColpHAD28 | Incompatibility group | ColRNAI |
Plasmid size | 2573 bp | Coordinate of oriT [Strand] | 1047..1105 [+] |
Host baterium | Enterobacter hormaechei subsp. xiangfangensis strain CNCI 200 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |