Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   122077
Name   oriT_BFG-353|unnamed1 in_silico
Organism   Bacteroides faecis strain BFG-353
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JANUJJ010000001 (1053..1225 [-], 173 nt)
oriT length   173 nt
IRs (inverted repeats)      57..63, 66..72  (CAATGGC..GCCATTG)
 18..23, 37..42  (AACTAC..GTAGTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 173 nt

>oriT_BFG-353|unnamed1
CCCTCGGGAGAGCCCACAACTACGTAAGCGGAGCGTGTAGTTATAGTGGGCTATATCAATGGCAAGCCATTGTCTGCAAACTCCAGCCTACGGCTTCCGCTCTCCTCCGTCAGGGAGGTTTTCATCATCGTTGCCGATTGGAGATGCACCGACCAGCACAAGGTCTAAATCGT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   22504 GenBank   NZ_JANUJJ010000001
Plasmid name   BFG-353|unnamed1 Incompatibility group   -
Plasmid size   11747 bp Coordinate of oriT [Strand]   1053..1225 [-]
Host baterium   Bacteroides faecis strain BFG-353

Cargo genes


Drug resistance gene   cfxA5
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -