Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 122071 |
| Name | oriT_pPCP1  |
| Organism | Yersinia pestis subsp. microtus bv. Ulegeica strain SCPM-O-B-6906 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JYJW01000321 (1593..1652 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pPCP1
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22498 | GenBank | NZ_JYJW01000321 |
| Plasmid name | pPCP1 | Incompatibility group | ColRNAI |
| Plasmid size | 2904 bp | Coordinate of oriT [Strand] | 1593..1652 [-] |
| Host baterium | Yersinia pestis subsp. microtus bv. Ulegeica strain SCPM-O-B-6906 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |