Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 122066 |
| Name | oriT_pMG828-1  |
| Organism | Acinetobacter baumannii strain INTEC_AI6 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JADDLT010000047 (307..393 [+], 87 nt) |
| oriT length | 87 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 87 nt
>oriT_pMG828-1
GGGGTGTCGGGGCGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT
GGGGTGTCGGGGCGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22493 | GenBank | NZ_JADDLT010000047 |
| Plasmid name | pMG828-1 | Incompatibility group | - |
| Plasmid size | 498 bp | Coordinate of oriT [Strand] | 307..393 [+] |
| Host baterium | Acinetobacter baumannii strain INTEC_AI6 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |