Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 122059 |
| Name | oriT_JX05|p1  |
| Organism | Pseudomonas aeruginosa strain JX05 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_WTXS01000211 (756..915 [-], 160 nt) |
| oriT length | 160 nt |
| IRs (inverted repeats) | 39..44, 48..53 (CCCTAC..GTAGGG) 6..12, 16..22 (GTTTCTC..GAGAAAC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GTGCGCCCTC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 160 nt
>oriT_JX05|p1
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22486 | GenBank | NZ_WTXS01000211 |
| Plasmid name | JX05|p1 | Incompatibility group | - |
| Plasmid size | 2261 bp | Coordinate of oriT [Strand] | 756..915 [-] |
| Host baterium | Pseudomonas aeruginosa strain JX05 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |