Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 122032 |
| Name | oriT_pCUVET18-1371.5  |
| Organism | Serratia nevei strain CUVET18-1371 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP115014 (2102..2161 [+], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pCUVET18-1371.5
GGGTTTCGGGGCGCAGGCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGGCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22459 | GenBank | NZ_CP115014 |
| Plasmid name | pCUVET18-1371.5 | Incompatibility group | Col440II |
| Plasmid size | 4947 bp | Coordinate of oriT [Strand] | 2102..2161 [+] |
| Host baterium | Serratia nevei strain CUVET18-1371 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |