Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 122002 |
| Name | oriT_pYC2 |
| Organism | Latilactobacillus sakei |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_011652 (1940..1970 [+], 31 nt) |
| oriT length | 31 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 31 nt
>oriT_pYC2
ACCACCCAATTTTGGAGTGGTGTGTAAGTGC
ACCACCCAATTTTGGAGTGGTGTGTAAGTGC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22429 | GenBank | NC_011652 |
| Plasmid name | pYC2 | Incompatibility group | - |
| Plasmid size | 1970 bp | Coordinate of oriT [Strand] | 1940..1970 [+] |
| Host baterium | Latilactobacillus sakei |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |