Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121950 |
| Name | oriT_pR109-1-A  |
| Organism | Enterococcus durans strain R109-1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP116580 (22265..22302 [+], 38 nt) |
| oriT length | 38 nt |
| IRs (inverted repeats) | 14..22, 29..37 (TAAAGTATA..TATACTTTA) 2..8, 13..19 (ACTTTAT..ATAAAGT) |
| Location of nic site | 27..28 |
| Conserved sequence flanking the nic site |
GTGTGTTATA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 38 nt
>oriT_pR109-1-A
CACTTTATGAATATAAAGTATAGTGTGTTATACTTTAC
CACTTTATGAATATAAAGTATAGTGTGTTATACTTTAC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22377 | GenBank | NZ_CP116580 |
| Plasmid name | pR109-1-A | Incompatibility group | - |
| Plasmid size | 27897 bp | Coordinate of oriT [Strand] | 22265..22302 [+] |
| Host baterium | Enterococcus durans strain R109-1 |
Cargo genes
| Drug resistance gene | poxtA, tet(M), tet(L), fexB |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |