Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121949 |
| Name | oriT_pK68-8-B  |
| Organism | Companilactobacillus farciminis strain K68-8 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP116589 (1625..1662 [-], 38 nt) |
| oriT length | 38 nt |
| IRs (inverted repeats) | 1..7, 19..25 (ACACAAC..GTTGTGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 38 nt
>oriT_pK68-8-B
ACACAACCAACTTTAGTTGTTGTGTGTAAGTGCGCATT
ACACAACCAACTTTAGTTGTTGTGTGTAAGTGCGCATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22376 | GenBank | NZ_CP116589 |
| Plasmid name | pK68-8-B | Incompatibility group | - |
| Plasmid size | 1814 bp | Coordinate of oriT [Strand] | 1625..1662 [-] |
| Host baterium | Companilactobacillus farciminis strain K68-8 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |