Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   121947
Name   oriT_p_A5351 in_silico
Organism   Pectobacterium sp. A5351
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP116476 (5811..5970 [-], 160 nt)
oriT length   160 nt
IRs (inverted repeats)      39..44, 48..53  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 160 nt

>oriT_p_A5351
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   22374 GenBank   NZ_CP116476
Plasmid name   p_A5351 Incompatibility group   IncQ1
Plasmid size   8688 bp Coordinate of oriT [Strand]   5811..5970 [-]
Host baterium   Pectobacterium sp. A5351

Cargo genes


Drug resistance gene   sul2, aph(3'')-Ib, aph(6)-Id
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -