Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121943 |
| Name | oriT_p3_120063  |
| Organism | Enterobacter roggenkampii strain 120063 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP116253 (2528..2586 [+], 59 nt) |
| oriT length | 59 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 59 nt
>oriT_p3_120063
GGTGTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGTGTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22370 | GenBank | NZ_CP116253 |
| Plasmid name | p3_120063 | Incompatibility group | Col440I |
| Plasmid size | 3062 bp | Coordinate of oriT [Strand] | 2528..2586 [+] |
| Host baterium | Enterobacter roggenkampii strain 120063 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |