Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   121942
Name   oriT_p2_120063 in_silico
Organism   Enterobacter roggenkampii strain 120063
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP116252 (6977..7033 [+], 57 nt)
oriT length   57 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 57 nt

>oriT_p2_120063
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   22369 GenBank   NZ_CP116252
Plasmid name   p2_120063 Incompatibility group   Col440II
Plasmid size   8252 bp Coordinate of oriT [Strand]   6977..7033 [+]
Host baterium   Enterobacter roggenkampii strain 120063

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -