Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121842 |
| Name | oriT_CM-TZ4|unnamed5  |
| Organism | Enterobacter ludwigii strain CM-TZ4 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP116352 (5239..5298 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_CM-TZ4|unnamed5
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22269 | GenBank | NZ_CP116352 |
| Plasmid name | CM-TZ4|unnamed5 | Incompatibility group | Col440II |
| Plasmid size | 5409 bp | Coordinate of oriT [Strand] | 5239..5298 [-] |
| Host baterium | Enterobacter ludwigii strain CM-TZ4 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |