Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121755 |
| Name | oriT_pPD584_L3  |
| Organism | Pseudomonas putida strain PD584_L3 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP115664 (2738..2848 [-], 111 nt) |
| oriT length | 111 nt |
| IRs (inverted repeats) | 71..77, 80..86 (CACCCGC..GCGGGTG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 111 nt
>oriT_pPD584_L3
CGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
CGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22182 | GenBank | NZ_CP115664 |
| Plasmid name | pPD584_L3 | Incompatibility group | IncP1 |
| Plasmid size | 8219 bp | Coordinate of oriT [Strand] | 2738..2848 [-] |
| Host baterium | Pseudomonas putida strain PD584_L3 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA9 |