Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   121754
Name   oriT_pPD584 in_silico
Organism   Pseudomonas putida strain PD584
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP115666 (2738..2848 [-], 111 nt)
oriT length   111 nt
IRs (inverted repeats)      71..77, 80..86  (CACCCGC..GCGGGTG)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 111 nt

>oriT_pPD584
CGGCCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCCTGCCCGG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   22181 GenBank   NZ_CP115666
Plasmid name   pPD584 Incompatibility group   IncP1
Plasmid size   8187 bp Coordinate of oriT [Strand]   2738..2848 [-]
Host baterium   Pseudomonas putida strain PD584

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA9