Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   121749
Name   oriT_2020CK-00204|unnamed5 in_silico
Organism   Enterobacter hormaechei strain 2020CK-00204
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP115694 (132..191 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_2020CK-00204|unnamed5
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   22176 GenBank   NZ_CP115694
Plasmid name   2020CK-00204|unnamed5 Incompatibility group   Col440II
Plasmid size   4938 bp Coordinate of oriT [Strand]   132..191 [-]
Host baterium   Enterobacter hormaechei strain 2020CK-00204

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -