Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121743 |
| Name | oriT_pAt8  |
| Organism | Agrobacterium tumefaciens strain cl001 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP048583 (641..678 [-], 38 nt) |
| oriT length | 38 nt |
| IRs (inverted repeats) | 19..24, 30..35 (CGTCGC..GCGACG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 38 nt
>oriT_pAt8
CCAAAGGGCGCAATTATACGTCGCTGATCGCGACGCCC
CCAAAGGGCGCAATTATACGTCGCTGATCGCGACGCCC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22170 | GenBank | NZ_CP048583 |
| Plasmid name | pAt8 | Incompatibility group | - |
| Plasmid size | 4002 bp | Coordinate of oriT [Strand] | 641..678 [-] |
| Host baterium | Agrobacterium tumefaciens strain cl001 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |