Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121734 |
| Name | oriT_pCRE4_2  |
| Organism | Klebsiella michiganensis strain S4_CRE4 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP074451 (56935..56984 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pCRE4_2
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22161 | GenBank | NZ_CP074451 |
| Plasmid name | pCRE4_2 | Incompatibility group | IncFIA |
| Plasmid size | 57005 bp | Coordinate of oriT [Strand] | 56935..56984 [-] |
| Host baterium | Klebsiella michiganensis strain S4_CRE4 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | arsH, arsC, arsB, silE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |