Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121701 |
| Name | oriT_2022CK-00496|unnamed4  |
| Organism | Klebsiella michiganensis strain 2022CK-00496 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP114153 (473..523 [-], 51 nt) |
| oriT length | 51 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 51 nt
>oriT_2022CK-00496|unnamed4
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGA
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22128 | GenBank | NZ_CP114153 |
| Plasmid name | 2022CK-00496|unnamed4 | Incompatibility group | Col440I |
| Plasmid size | 5524 bp | Coordinate of oriT [Strand] | 473..523 [-] |
| Host baterium | Klebsiella michiganensis strain 2022CK-00496 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |