Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121683 |
| Name | oriT_p51_4_2kb  |
| Organism | Enterococcus faecium strain Dallas 51_4 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP066398 (26..201 [-], 176 nt) |
| oriT length | 176 nt |
| IRs (inverted repeats) | 91..98, 105..112 (ATTTTTTG..CAAAAAAT) 26..34, 37..45 (CACCTTCCT..AGGAAGGTG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 176 nt
>oriT_p51_4_2kb
AAAGAGCATAAGGGAAAACTGATAGCACCTTCCTACAGGAAGGTGGCTAAGTCGGCTGTGCCAACTGGTTTTCTTACAAAACAACCTTATATTTTTTGATATCACAAAAAATCCATTTTGGACCTATTTTCGGTCATAATATAGTACCTACTTTTGGTCATAGTTTCGTCCGTAGT
AAAGAGCATAAGGGAAAACTGATAGCACCTTCCTACAGGAAGGTGGCTAAGTCGGCTGTGCCAACTGGTTTTCTTACAAAACAACCTTATATTTTTTGATATCACAAAAAATCCATTTTGGACCTATTTTCGGTCATAATATAGTACCTACTTTTGGTCATAGTTTCGTCCGTAGT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22110 | GenBank | NZ_CP066398 |
| Plasmid name | p51_4_2kb | Incompatibility group | - |
| Plasmid size | 2055 bp | Coordinate of oriT [Strand] | 26..201 [-] |
| Host baterium | Enterococcus faecium strain Dallas 51_4 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |