Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121663 |
| Name | oriT_MB-3u-03|unnamed4  |
| Organism | Planococcus sp. MB-3u-03 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP025127 (3070..3107 [+], 38 nt) |
| oriT length | 38 nt |
| IRs (inverted repeats) | 1..6, 10..15 (CTTTAT..ATAAAG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 38 nt
>oriT_MB-3u-03|unnamed4
CTTTATGCAATAAAGTATAGTGTGCTATACTTTACATG
CTTTATGCAATAAAGTATAGTGTGCTATACTTTACATG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22090 | GenBank | NZ_CP025127 |
| Plasmid name | MB-3u-03|unnamed4 | Incompatibility group | - |
| Plasmid size | 6800 bp | Coordinate of oriT [Strand] | 3070..3107 [+] |
| Host baterium | Planococcus sp. MB-3u-03 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |