Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121657 |
| Name | oriT_IncHI1BpNDM-MAR  |
| Organism | Enterobacter hormaechei subsp. xiangfangensis strain MDCL 3 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP115151 (101287..101314 [+], 28 nt) |
| oriT length | 28 nt |
| IRs (inverted repeats) | 16..21, 23..28 (ATCAGA..TCTGAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 28 nt
>oriT_IncHI1BpNDM-MAR
AGTTTGGTGCTTATGATCAGAATCTGAT
AGTTTGGTGCTTATGATCAGAATCTGAT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22084 | GenBank | NZ_CP115151 |
| Plasmid name | IncHI1BpNDM-MAR | Incompatibility group | IncHI1B |
| Plasmid size | 200030 bp | Coordinate of oriT [Strand] | 101287..101314 [+] |
| Host baterium | Enterobacter hormaechei subsp. xiangfangensis strain MDCL 3 |
Cargo genes
| Drug resistance gene | rmtC, blaNDM-1, sul1, aac(3)-IId, qacE, aac(6')-Ib |
| Virulence gene | iucA, iucB, iucC, iutA |
| Metal resistance gene | pbrA, terE, terD, terC, terB, terA, terZ, terW, merR, merT, merP, merC, merA, merD, merE, silE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |