Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121628 |
| Name | oriT_FDAARGOS_1029|unnamed1  |
| Organism | Citrobacter koseri strain FDAARGOS_1029 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP066090 (4005..4062 [-], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | 29..36, 39..46 (CACAGCGT..ACGCTGTG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_FDAARGOS_1029|unnamed1
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACAGCGTTTACGCTGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACAGCGTTTACGCTGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22055 | GenBank | NZ_CP066090 |
| Plasmid name | FDAARGOS_1029|unnamed1 | Incompatibility group | ColRNAI |
| Plasmid size | 5601 bp | Coordinate of oriT [Strand] | 4005..4062 [-] |
| Host baterium | Citrobacter koseri strain FDAARGOS_1029 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |