Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   121599
Name   oriT_pT211 in_silico
Organism   Proteus mirabilis strain T21
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP017083 (15228..15325 [+], 98 nt)
oriT length   98 nt
IRs (inverted repeats)      77..82, 88..93  (AAAAAA..TTTTTT)
 31..38, 41..48  (AGCGTGAT..ATCACGCT)
 17..23, 35..41  (TAAATCA..TGATTTA)
Location of nic site      59..60
Conserved sequence flanking the
  nic site  
 
 GGTGTATAGC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 98 nt

>oriT_pT211
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTGGTAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   22026 GenBank   NZ_CP017083
Plasmid name   pT211 Incompatibility group   IncN
Plasmid size   24225 bp Coordinate of oriT [Strand]   15228..15325 [+]
Host baterium   Proteus mirabilis strain T21

Cargo genes


Drug resistance gene   blaKPC-2
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -