Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121595 |
| Name | oriT_pA18-1  |
| Organism | Citrobacter freundii strain 18-1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP022274 (59616..59720 [-], 105 nt) |
| oriT length | 105 nt |
| IRs (inverted repeats) | 56..61, 74..79 (TGGAAT..ATTCCA) 46..51, 56..61 (ATTCCA..TGGAAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 105 nt
>oriT_pA18-1
AAATTGACAAATTCCAAACATGGGTTAGCCTAGTGACAAAACTAGATTCCAATAGTGGAATAATTAGGTTTAGATTCCAGATAGATAGTTATGTGGATAGGAATT
AAATTGACAAATTCCAAACATGGGTTAGCCTAGTGACAAAACTAGATTCCAATAGTGGAATAATTAGGTTTAGATTCCAGATAGATAGTTATGTGGATAGGAATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 22022 | GenBank | NZ_CP022274 |
| Plasmid name | pA18-1 | Incompatibility group | IncA/C |
| Plasmid size | 159655 bp | Coordinate of oriT [Strand] | 59616..59720 [-] |
| Host baterium | Citrobacter freundii strain 18-1 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | merR2, merT, merP, arsA, arsD, arsR |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |