Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121543 |
| Name | oriT_pLd5  |
| Organism | Lactococcus lactis subsp. lactis bv. diacetylactis strain FM03 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP020609 (6448..6584 [+], 137 nt) |
| oriT length | 137 nt |
| IRs (inverted repeats) | 21..28, 42..49 (AAAAGGGG..CCCCTTTT) 25..30, 39..44 (GGGGAA..TTCCCC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 137 nt
>oriT_pLd5
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCCACATTGTAATACAAGAACGAAGTAATTTGTATTACAATGTGATAGCTTACAGTATTTATGGTTTTATATTTCCTATTTTGTT
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCCACATTGTAATACAAGAACGAAGTAATTTGTATTACAATGTGATAGCTTACAGTATTTATGGTTTTATATTTCCTATTTTGTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21970 | GenBank | NZ_CP020609 |
| Plasmid name | pLd5 | Incompatibility group | - |
| Plasmid size | 7521 bp | Coordinate of oriT [Strand] | 6448..6584 [+] |
| Host baterium | Lactococcus lactis subsp. lactis bv. diacetylactis strain FM03 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |