Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   121537
Name   oriT_pLL441-6 in_silico
Organism   Lactiplantibacillus plantarum strain LL441
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP114880 (6831..6863 [-], 33 nt)
oriT length   33 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 33 nt

>oriT_pLL441-6
CCACCAAATTTTAGTGGGGTGTAAGTGCGCATT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   21964 GenBank   NZ_CP114880
Plasmid name   pLL441-6 Incompatibility group   -
Plasmid size   8844 bp Coordinate of oriT [Strand]   6831..6863 [-]
Host baterium   Lactiplantibacillus plantarum strain LL441

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -