Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121537 |
| Name | oriT_pLL441-6  |
| Organism | Lactiplantibacillus plantarum strain LL441 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP114880 (6831..6863 [-], 33 nt) |
| oriT length | 33 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 33 nt
>oriT_pLL441-6
CCACCAAATTTTAGTGGGGTGTAAGTGCGCATT
CCACCAAATTTTAGTGGGGTGTAAGTGCGCATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21964 | GenBank | NZ_CP114880 |
| Plasmid name | pLL441-6 | Incompatibility group | - |
| Plasmid size | 8844 bp | Coordinate of oriT [Strand] | 6831..6863 [-] |
| Host baterium | Lactiplantibacillus plantarum strain LL441 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |