Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   121519
Name   oriT_FDAARGOS_892|unnamed2 in_silico
Organism   Enterobacter asburiae strain FDAARGOS_892
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP065694 (4578..4637 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_FDAARGOS_892|unnamed2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   21946 GenBank   NZ_CP065694
Plasmid name   FDAARGOS_892|unnamed2 Incompatibility group   ColRNAI
Plasmid size   4783 bp Coordinate of oriT [Strand]   4578..4637 [+]
Host baterium   Enterobacter asburiae strain FDAARGOS_892

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -