Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121493 |
| Name | oriT_pVE80-2  |
| Organism | Enterococcus saigonensis strain VE80 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_AP022824 (2591..2627 [+], 37 nt) |
| oriT length | 37 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 37 nt
>oriT_pVE80-2
TACGTAGAAACGAAGTTACTGCGTATAAGTGCGCCCT
TACGTAGAAACGAAGTTACTGCGTATAAGTGCGCCCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21920 | GenBank | NZ_AP022824 |
| Plasmid name | pVE80-2 | Incompatibility group | - |
| Plasmid size | 25275 bp | Coordinate of oriT [Strand] | 2591..2627 [+] |
| Host baterium | Enterococcus saigonensis strain VE80 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |