Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121482 |
| Name | oriT_pbSTHERMO  |
| Organism | Streptococcus thermophilus isolate STH_CIRM_956 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_LR822022 (1977..2031 [+], 55 nt) |
| oriT length | 55 nt |
| IRs (inverted repeats) | 29..34, 40..45 (AAGGGA..TCCCTT) 1..6, 10..15 (GTTGAT..ATCAAC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 55 nt
>oriT_pbSTHERMO
GTTGATTCTATCAACTCCCTGAGGAACGAAGGGACAGTTTCCCTTATGCTCTTTT
GTTGATTCTATCAACTCCCTGAGGAACGAAGGGACAGTTTCCCTTATGCTCTTTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21909 | GenBank | NZ_LR822022 |
| Plasmid name | pbSTHERMO | Incompatibility group | - |
| Plasmid size | 2162 bp | Coordinate of oriT [Strand] | 1977..2031 [+] |
| Host baterium | Streptococcus thermophilus isolate STH_CIRM_956 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |